rs11793060 chr9:130532569 T>C
- Sequence
ccttggcctaccaaagtggtagga[T/C]tacaggcatgagccagcatgccca
- ASB in cell types
- BJ (fibroblasts)
- ASB for transcription factors
- P63_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| P63_HUMAN | 1.62 | -0.81 | 1.00 | 0.39 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
