rs117994996 chr8:19757045 C>A
- Sequence
ggaggccaggcgcggcaccgtcct[C/A]cgcagctgcacgagccaccccgag
- ASB in cell types
- prostate gland
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| prostate gland | -2.06 | 2.33 | 1.00 |
Items per page:
1 – 1 of 1