rs11842 chr2:47176244 G>T
- Sequence
ccggccctcaactcactagaggaa[G/T]cccccctgaagagaatgggggtgg
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) BEAS-2B (bronchial epithelium) breast tumor
- ASB for transcription factors
- NFXL1_HUMAN GCR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NFXL1_HUMAN | 2.48 | -0.09 | 1.00 | n/a | n/a | |||
| GCR_HUMAN | 0.84 | 1.32 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2