rs11844118 chr14:23895597 C>A
- Sequence
tagcaaactagaagttgtttccct[C/A]ctggcatatatcttaccacgccat
- ASB in cell types
- 2588 (Lymphoblastoid Cell Lines) GM19099 (female B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 2588 (Lymphoblastoid Cell Lines) | 1.82 | -1.47 | 1.00 | |||
| GM19099 (female B-cells Lymphoblastoid Cell Lines) | 1.80 | 0.05 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adrenal_Gland, Artery_Tibial, Breast_Mammary_Tissue, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Pituitary, Testis, Thyroid