rs11851414 chr14:68792785 T>C
- Sequence
aaaagaatcatctcgctgcaccac[T/C]ttccccattgccttccaagaccca
- ASB in cell types
- primary B-CLL cells breast tumor A549 (lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| primary B-CLL cells | 2.03 | -1.09 | 3.00 | |||
| breast tumor | 2.79 | -0.69 | 2.00 | |||
| A549 (lung carcinoma) | 1.04 | 0.34 | 2.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, celiac disease, diastolic blood pressure (dbp), fasting insulin, homa-b, homa-ir, microalbuminuria, mitral annular calcium, sporadic creutzfeldt-jakob disease, urinary albumin-to-creatinine ratio