rs11870045 chr17:80890621 C>T
- Sequence
ttccatcggcgcaaatcaagaggg[C/T]gctgcaggctgaagggaaagtaga
- ASB in cell types
- BCBL-1 (B-cell lymphoma) HT1080 (fibrosarcoma)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 2.20 | -0.06 | 1.83 | -2.11 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
