rs11880926 chr19:52592513 T>G
- Sequence
gcccctggaggccctgagcggaat[T/G]gtcaccatggcccaggatatgaga
- ASB in cell types
- GM23338 bipolar neuron MS-1 (Small cell lung carcinoma)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 2.65 | -0.66 | 1.40 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Muscle_Skeletal, Spleen, Stomach, Testis, Thyroid