rs11886502 chr2:62293546 A>C
- Sequence
tgaagtgtgcccggtgaggtgtga[A/C]tccagcaacccagggcagggattg
- ASB in cell types
- SK-BR-3 (breast adenocarcinoma) GM02610 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- ERR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ERR1_HUMAN | -1.30 | 1.92 | 1.10 | n/a | No Hit |
Items per page:
1 – 1 of 1