rs11924032 chr3:171017310 G>A
- Sequence
tgttgtcatcacccacacaaaaaa[G/A]atatgacccttgtctcttgacccc
- ASB for transcription factors
- RARA_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RARA_HUMAN | -0.27 | 2.31 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP age at death with kuru exposure, college completion, fasting blood glucose, fasting insulin, height (pygmy height), homa-b, negative mood delusions in patients with bipolar disease, primary rhegmatogenous retinal detachment, transmission distortion, triglycerides, type 2 diabetes, variant creutzfeldt-jakob disease, years of education