rs11940316 chr4:69095409 T>C
- Sequence
gatcagctggcatcagtgaagtct[T/C]tcagatcagctgacatcagtgaga
- ASB in cell types
- K562 (myelogenous leukemia) MOLM14 (Adult acute myeloid leukemia)
- ASB for transcription factors
- CDK8_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CDK8_HUMAN | n/a | 2.49 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, advanced age-related macular degeneration (geographic atrophy)
GTEx eQTL Breast_Mammary_Tissue, Colon_Transverse, Heart_Atrial_Appendage, Liver, Lung, Minor_Salivary_Gland, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid