rs11945012 chr4:140427103 A>C
- Sequence
gcgccccgggccccctctacaacc[A/C]ttgggagagcgccccgggctcaag
- ASB in cell types
- GM10847 (female B-cells Lymphoblastoid Cell Lines) GM19239 (male B-cells lymphoblastoid cell line) LNCaP (prostate carcinoma)
- ASB for transcription factors
- CTCF_HUMAN MAON_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 2.78 | 0.44 | 1.38 | n/a | No Hit | |||
| MAON_HUMAN | 1.83 | -1.19 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Cells_Cultured_fibroblasts, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach