rs11957803 chr5:89050550 G>C
- Sequence
gatctttgtgacctattccctgtt[G/C]gtgcaccccctccccttttgaaat
- ASB in cell types
- CD34+ hematopoietic stem cells
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CD34+ hematopoietic stem cells | 2.27 | -1.33 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP fasting insulin, femoral neck bone mineral density (bmd), femoral neck bone mineral density (bmd) (females), femoral neck bone mineral density (bmd) (males), height, homa-ir, mitral annular calcium