rs11981109 chr7:46258149 G>A
- Sequence
aattcataacattaatctatgcct[G/A]tcttgtggcctccctgctccctta
- ASB in cell types
- neural progenitors
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neural progenitors | 1.86 | 0.25 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), height, ldl cholesterol, salmonella-induced pyroptosis, sporadic creutzfeldt-jakob disease, transmission distortion, triglycerides