rs1201971 chr20:60715378 T>C
- Sequence
gggggcgcaggcagcacctgagct[T/C]cagctcctcccaccaggctctgcc
- ASB in cell types
- IMR-5 (Neuroblastoma) SYO-1(Biphasic synovial sarcoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| IMR-5 (Neuroblastoma) | n/a | 3.04 | 1.33 | |||
| SYO-1(Biphasic synovial sarcoma) | -2.19 | 2.59 | 1.00 |
Items per page:
1 – 2 of 2