rs120206 chr11:69515622 C>T
- Sequence
tgctgcctgcccaaaggcttctgg[C/T]tgggcttgctcttcctggacactt
- ASB in cell types
- T47D (invasive ductal carcinoma) breast tumor MCF7L-P(immortalized breast epithelial cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| T47D (invasive ductal carcinoma) | 1.07 | 0.02 | 1.38 | |||
| breast tumor | 1.72 | 0.29 | 2.00 | |||
| MCF7L-P(immortalized breast epithelial cell line) | 0.98 | -0.22 | 1.50 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), birth weight, multiple myeloma, sporadic creutzfeldt-jakob disease