rs12028581 chr1:234772423 C>T
- Sequence
aaacaaacactgggtttaggcatt[C/T]tgctctcccagcaccgcatggctg
- ASB in cell types
- MOLM14 (Adult acute myeloid leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MOLM14 (Adult acute myeloid leukemia) | 1.00 | -2.77 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder, comorbid depressive syndrome and alcohol dependence, diabetic retinopathy in type 2 diabetes mellitus, hdl cholesterol, height, major depressive disorder, mitral annular calcium, type 2 diabetes, type 2 diabetes (females), type 2 diabetes (males), type 2 diabetes family history