rs12029583 chr1:4497967 T>C
- Sequence
tgaatgcttggccaggtgactaaa[T/C]gcaatcagcagccccttctcccct
- ASB in cell types
- iPSC (induced pluripotent stem cells)
- ASB for transcription factors
- DUX4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| DUX4_HUMAN | 2.19 | -1.85 | 1.00 | 0.26 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
