rs12040358 chr1:17999075 A>T
- Sequence
aagtgccccctgccggtgagtgag[A/T]aggtggtgctgtgggtgagcacag
- ASB in cell types
- MCF7L-P(immortalized breast epithelial cell line) MS-1 (Small cell lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7L-P(immortalized breast epithelial cell line) | 2.11 | 0.69 | 2.00 | |||
| MS-1 (Small cell lung carcinoma) | n/a | 1.03 | 3.00 |
Items per page:
1 – 2 of 2