rs12043526 chr1:247373844 G>T
- Sequence
gggagtgtgaaagcgaccagccct[G/T]cagaggcttccccgcgccccgcgc
- ASB in cell types
- GM12892 (female B-cells lymphoblastoid cell line) GM12891 (male B- cells lymphoblastoid cell line) PANC1 (pancreatic ductal adenocarcinoma)
- ASB for transcription factors
- STAG1_HUMAN CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 1.94 | 2.59 | 1.00 | n/a | n/a | |||
| CTCF_HUMAN | 1.37 | 0.84 | 1.28 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP comorbid depressive syndrome and alcohol dependence, hypertension (early onset hypertension), obesity with early age of onset (age >2), paternal transmission distortion, sporadic creutzfeldt-jakob disease, transmission distortion, urinary albumin-to-creatinine ratio