rs12046452 chr1:184222582 C>T
- Sequence
ggttccctagttcttctgtggcct[C/T]gactcccaactgtgtgaaacctgc
- ASB in cell types
- OCI-LY7 (diffuse large B-cell lymphoma) GBM39 (Human brain tumor)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| OCI-LY7 (diffuse large B-cell lymphoma) | -1.86 | 1.91 | 1.00 | |||
| GBM39 (Human brain tumor) | -0.24 | 1.50 | 1.50 |
Items per page:
1 – 2 of 2