rs12073947 chr1:67897807 A>C
- Sequence
agagttcagctgaaggacaggaag[A/C]aaaaccataaaacccttacatatc
- ASB in cell types
- NALM-6 (adult B acute lymphoblastic leukemia)
- ASB for transcription factors
- COE1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| COE1_HUMAN | -0.84 | 2.50 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1