rs12090783 chr1:34014018 T>G
- Sequence
cctcagttaagggcagctccatac[T/G]gcccgttgatccccccaaaccctg
- ASB in cell types
- foreskin keratinocyte K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 1.94 | -0.14 | 2.00 | |||
| K562 (myelogenous leukemia) | -0.07 | 0.95 | 1.12 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), aortic valve calcium, ldl cholesterol