rs12100587 chr14:105537986 T>G
- Sequence
tgagaaccctacctggctggggca[T/G]gcgggagcctctggaccttcgcgc
- ASB in cell types
- KMS-11 (Plasma cell myeloma) epithelial cell of proximal tubule
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| KMS-11 (Plasma cell myeloma) | -3.93 | 2.37 | 1.83 | |||
| epithelial cell of proximal tubule | 2.15 | -1.95 | 1.00 |
Items per page:
1 – 2 of 2