rs12105962 chr2:231000429 G>C
- Sequence
ccacttgcccctgcagctccgctt[G/C]ctggcgtcgtctggggctatgcca
- ASB in cell types
- MCF7L-P(immortalized breast epithelial cell line) pancreas
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7L-P(immortalized breast epithelial cell line) | -1.19 | 1.37 | 1.50 | |||
| pancreas | 1.75 | -1.44 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Caudate_basal_ganglia, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Nerve_Tibial, Testis