rs12123965 chr1:109822547 C>T
- Sequence
agggcttgctgagtaatgtcctca[C/T]ggagaatggccaaaaataaggagg
- ASB in cell types
- CD14+ monocytes monocyte-derived macrophages from peripheral blood MDM(monocyte derived macrophages)
- ASB for transcription factors
- SPI1_HUMAN STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 2.43 | 0.75 | 1.80 | n/a | No Hit | |||
| STAT1_HUMAN | 1.25 | -0.27 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2