rs12129611 chr1:56332238 T>A
- Sequence
ccacacgcagcctgacagagtgaa[T/A]ggcaacctcttcaaatcggttctt
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- ELF1_HUMAN RELB_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ELF1_HUMAN | -2.24 | 2.36 | 1.00 | n/a | No Hit | |||
| RELB_HUMAN | -1.65 | 2.02 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), systolic blood pressure (sbp), triglycerides