rs12141491 chr1:191963445 T>A
- Sequence
caccattatgctatgagtagcatg[T/A]ggtaaggggcctagcatgtagagg
- ASB in cell types
- MDM(monocyte derived macrophages) MOLM14 (Adult acute myeloid leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MDM(monocyte derived macrophages) | -1.26 | 1.69 | 1.50 | |||
| MOLM14 (Adult acute myeloid leukemia) | 2.10 | -1.02 | 2.00 |
Items per page:
1 – 2 of 2