rs12146628 chr11:104332242 G>C
- Sequence
cttattcagactatgaagaaccag[G/C]gtctaactacgttcacattactgg
- ASB in cell types
- epithelial cell of prostate Peyer's patch foreskin keratinocyte ID00014 (lymphoblastoid cell, DiGeorge syndrome)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| epithelial cell of prostate | -2.21 | 2.59 | 1.00 | |||
| Peyer's patch | n/a | 2.92 | 1.00 | |||
| foreskin keratinocyte | 2.30 | -4.44 | 2.25 | |||
| ID00014 (lymphoblastoid cell, DiGeorge syndrome) | -2.24 | 2.50 | 1.00 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cerebellar_Hemisphere, Brain_Spinal_cord_cervical_c-1, Heart_Atrial_Appendage, Nerve_Tibial