rs12150092 chr17:70887951 T>G
- Sequence
ttatctgagtcttagctccaaagt[T/G]agtccatttataaataatatcatt
- ASB in cell types
- WA01 (H1, human embryonic stem cells) iPSC (induced pluripotent stem cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| WA01 (H1, human embryonic stem cells) | 2.28 | -1.98 | 1.00 | |||
| iPSC (induced pluripotent stem cells) | -1.60 | 1.97 | 1.00 |
Items per page:
1 – 2 of 2