rs12156473 chr9:76420129 A>T
- Sequence
ttagaaattgcttaggacttcaaa[A/T]cagatttgtgttgccagagcacag
- ASB in cell types
- GM12891 (male B- cells lymphoblastoid cell line) H929 (plasma cell myeloma) LUHMES (lund human mesencephalic cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12891 (male B- cells lymphoblastoid cell line) | -0.96 | 1.25 | 1.00 | |||
| H929 (plasma cell myeloma) | 1.90 | -1.63 | 1.00 | |||
| LUHMES (lund human mesencephalic cells) | 2.07 | -0.18 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adrenal_Gland, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Heart_Atrial_Appendage, Muscle_Skeletal, Nerve_Tibial, Pancreas, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg