rs12164496 chr1:19081641 G>C
- Sequence
aggacccggcagcaagagcaggaa[G/C]aatttgctcaatttgtcgttgtct
- ASB in cell types
- MDM(monocyte derived macrophages) monocyte-derived macrophages from peripheral blood
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 2.74 | -0.55 | 2.33 | n/a | No Hit |
Items per page:
1 – 1 of 1