rs1217397 chr1:113904943 G>A
- Sequence
accctaggctcttcaggccctacc[G/A]tcggccggcaggccgttcgccccg
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) neutrophils from periferal blood CTV-1 (Adult T acute lymphoblastic leukemia)
- ASB for transcription factors
- RBBP5_HUMAN HSF1_HUMAN RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RBBP5_HUMAN | 2.78 | n/a | 2.50 | n/a | n/a | |||
| HSF1_HUMAN | 2.92 | -0.39 | 3.33 | n/a | No Hit | |||
| RAD21_HUMAN | 2.47 | 0.70 | 1.36 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, acute lung injury following major trauma, advanced age-related macular degeneration, chronic kidney disease, prop taste detection threshold, rheumatoid arthritis, serum creatinine, total cholesterol change with statins
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Ovary, Testis, Thyroid, Whole_Blood