rs12196203 chr6:154960582 A>T
- Sequence
catgccatctaatcgcttcactgg[A/T]ttccgatctccaagagcacacagt
- ASB in cell types
- HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 1.04 | 0.05 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP birth weight, mitral annular calcium, obesity with early age of onset (age >2), simpson-angus scale