rs12197755 chr6:45419758 T>G
- Sequence
gctcctggctgcgcttccagttgg[T/G]ccggtctggctaaatgggttctcg
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) MV-4-11 (Childhood acute monocytic leukemia)
- ASB for transcription factors
- KMT2A_HUMAN RARA_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| KMT2A_HUMAN | -0.73 | 2.32 | 1.00 | n/a | n/a | |||
| RARA_HUMAN | 2.00 | -0.98 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Cells_Cultured_fibroblasts, Testis