rs12216877 chr8:81154703 G>A
- Sequence
ctggtctcaaactcctgaccccag[G/A]tgatccacctgccttggcctccca
- ASB in cell types
- macrophages
- ASB for transcription factors
- CEBPB_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CEBPB_HUMAN | n/a | 2.24 | 4.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Artery_Coronary, Cells_Cultured_fibroblasts, Lung, Nerve_Tibial, Spleen, Whole_Blood