rs12253075 chr10:61176669 C>A
- Sequence
gtgattgcaatggagatagcataa[C/A]cagcaaagctgaaaatatttaaca
- ASB in cell types
- endometrial stromal cells
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| endometrial stromal cells | 2.21 | n/a | 2.50 |
Items per page:
1 – 1 of 1