rs12258038 chr10:30718530 C>T
- Sequence
gggctcgctgcaacctctgcctcc[C/T]gagttcaagcaattcccctgcctc
- ASB in cell types
- GM19239 (male B-cells lymphoblastoid cell line) LNCaP (prostate carcinoma) erythroid cells GM10847 (female B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19239 (male B-cells lymphoblastoid cell line) | -0.92 | 1.16 | 1.00 | |||
| LNCaP (prostate carcinoma) | -0.24 | 1.79 | 1.00 | |||
| erythroid cells | 2.21 | -1.47 | 2.00 | |||
| GM10847 (female B-cells Lymphoblastoid Cell Lines) | -0.52 | 0.89 | 1.00 |
Items per page:
1 – 4 of 4