rs12261 chr13:98448293 T>C
- Sequence
tgcctcgcgaccccacgtgttgag[T/C]cacaaagagtctcttgtgtattga
- ASB in cell types
- RWPE2 epithelial cell of prostate
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.15 | 1.54 | 1.38 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP college completion, parkinsons disease, refractive error, salmonella-induced pyroptosis, spine bone mineral density (bmd), suicide attempts in bipolar disorder, total cholesterol, years of education
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Coronary, Artery_Tibial, Brain_Cerebellum, Colon_Transverse, Esophagus_Mucosa, Lung, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood