rs12272467 chr11:5596757 G>A
- Sequence
ctcggaacggaacggagcagagtc[G/A]tgcgtggttgagtttagataaaag
- ASB in cell types
- TF-1 (erythroleukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| TF-1 (erythroleukemia) | -0.77 | 1.35 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Coronary, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood