rs12289703 chr11:18634627 G>A
- Sequence
ctggtggcccgggcgcgcggtctt[G/A]tcatcttgttgctccttgtgagcg
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) primary B-CLL cells
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.83 | 0.59 | 1.20 | |||
| primary B-CLL cells | 2.06 | -1.33 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder, bipolar disorder and schizophrenia, cystatin c in serum, hdl cholesterol, ldl cholesterol, rheumatoid arthritis, total cholesterol
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cortex, Brain_Nucleus_accumbens_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid