rs12306 chr17:27295085 G>T
- Sequence
aaggcttttctggcttagtgtcta[G/T]ccctggtcggcttagtaaagggca
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.80 | 0.69 | 1.02 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), body mass index (bmi), hdl cholesterol, height, hiv-1 mother-to-child transmission, hiv-1 mother-to-child transmission (intrapartum transmission), ldl cholesterol, microalbuminuria, total cholesterol, urinary albumin-to-creatinine ratio