rs12345537 chr9:21183350 A>G
- Sequence
ttttatttccttttttgctaagct[A/G]ctgttatgtcattgtaacagtgac
- ASB in cell types
- HeLa (cervical adenocarcinoma) foreskin keratinocyte H929 (plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HeLa (cervical adenocarcinoma) | 0.03 | 2.23 | 2.00 | |||
| foreskin keratinocyte | 1.20 | -3.98 | 2.00 | |||
| H929 (plasma cell myeloma) | 1.57 | -1.36 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Hippocampus, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Nerve_Tibial