rs12355893 chr10:110547414 T>G
- Sequence
aaccattcgcctttcctgctgatg[T/G]tgaacatggcccctttttttctga
- ASB in cell types
- hepatocytes neutrophils from periferal blood
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| hepatocytes | 1.54 | -0.80 | 1.00 | |||
| neutrophils from periferal blood | 1.94 | -0.17 | 1.50 |
Items per page:
1 – 2 of 2