rs12364606 chr11:117810072 T>C
- Sequence
ctcacacacattcacacactcact[T/C]acacattcgcacacacatacacac
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney)
- ASB for transcription factors
- EGR1_HUMAN ZBT40_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| EGR1_HUMAN | -1.89 | 2.45 | 2.00 | 2.34 | Concordant | |||
| ZBT40_HUMAN | -2.06 | 2.84 | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), college completion, height, lung function, forced expiratory volume in 1 second (fev1) percent predicted (in asthmatic participants)