rs12365944 chr11:86740978 G>A
- Sequence
tggaggccctggaataggcctctc[G/A]tttgcctgcccttggccactcaga
- ASB in cell types
- 22RV1 (prostate carcinoma) A549 (lung carcinoma)
- ASB for transcription factors
- ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 2.07 | 0.17 | 1.83 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, hdl cholesterol, lung function, predicted ratio of forced expiratory volume in 1 second (fev1) to forced vital capacity (fvc) (fev1/fvc), lung function, ratio of forced expiratory volume in 1 second (fev1) to forced vital capacity (fvc) (fev1/fvc), refractive error, triglycerides
GTEx eQTL Adrenal_Gland, Artery_Tibial, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Pituitary