rs12410007 chr1:14937774 A>G
- Sequence
catctggctcctctcagtcttccc[A/G]gtgggagtctgatcttccagcctg
- ASB in cell types
- D341 Med (medulloblastoma)
- ASB for transcription factors
- NDF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NDF1_HUMAN | 2.30 | -1.98 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, adiponectin levels, body mass index (bmi), brain microstructure and intellectual performance, diabetic retinopathy in type 2 diabetes mellitus, obesity with early age of onset (age >2)