rs12414916 chr10:88027655 T>A
- Sequence
ccagtgtggccctggggagcagtt[T/A]ctgttctggcctgatctggattcc
- ASB in cell types
- CD14+ monocytes monocyte-derived macrophages from peripheral blood
- ASB for transcription factors
- STAT1_HUMAN SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | 2.65 | n/a | 3.00 | n/a | No Hit | |||
| SPI1_HUMAN | 2.02 | 0.41 | 2.25 | n/a | No Hit |
Items per page:
1 – 2 of 2