rs12416783 chr11:14905011 C>T
- Sequence
agcgccccctgtcggccgcgaagg[C/T]gtggcggcccgcggaccggcggac
- ASB in cell types
- erythroid progenitors CUTLL1 (T-cell lymphoblastic lymphoma 1)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| erythroid progenitors | 3.11 | n/a | 2.00 | |||
| CUTLL1 (T-cell lymphoblastic lymphoma 1) | n/a | 2.43 | 2.50 |
Items per page:
1 – 2 of 2