rs12417692 chr11:70196317 G>C
- Sequence
ggctgcctgcaggagctgcactca[G/C]ggaagggaaaggccccgcacctgg
- ASB in cell types
- HEK293 (embryonic kidney) MCF7 (Invasive ductal breast carcinoma) THP-1 (acute monocytic leukemia) CD34+ hematopoietic stem cells
- ASB for transcription factors
- RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RAD21_HUMAN | 1.13 | 0.44 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1