rs12434551 chr14:68786647 A>T
- Sequence
cttcggaagaggcctggtggaatc[A/T]tggtgactcagctgaactcccaaa
- ASB in cell types
- MCF10A (breast epithelial cells)
- ASB for transcription factors
- TEAD4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TEAD4_HUMAN | -2.13 | 2.53 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP fasting blood glucose, homa-b, juvenile idiopathic arthritis (including oligoarticular and rheumatoid factor-negative polyarticular jia), multiple sclerosis (progressive multiple sclerosis), oligoarticular juvenile idiopathic arthritis, rheumatoid arthritis, rheumatoid factor-negative polyarticular juvenile idiopathic arthritis